|
Category: W |
|
Antioxidant, Antimicrobial, Phytochemical and FTIR Analysis of Peganum hermala (fruit) Ethanolic Extract from Cholistan Desert
|
|
he aim of this study was to evaluate antioxidant and antimicrobial potential of Peganum harmala fruit. Ethanolic extract was prepared and phytochemical screening showed the presence of a lot of chemical compounds. Fourier transform infrared spectroscopy (FTIR) spectra indicated the presence of organic acids, hydroxyl and phenolic compounds, amino groups, aliphatic compounds, and functional groups such as amide, ketone, aldehyde, aromatics, and halogen compounds. Antioxidant activity of the ethanolic extract of P. harmala by the DPPH method showed 71.4% inhibition, whereas IC50 ± SEM (µg/mL) was .406 ± .11. Antibacterial activity was performed against Escherichia coli, Bacillus subtilis, Bacillus pumilus, Micrococcus luteus, Pseudomonas aeruginosa, Staphylococcus aureus, Staphylococcus epidermidis and Bordetella bronchiseptica.
|
| Year:
2022 |
|
|
Category: W |
|
Double-Stranded Break Repair in Mammalian Cells and Precise Genome Editing
|
|
In mammalian cells, double-strand breaks (DSBs) are repaired predominantly by error-prone non-homologous end joining (NHEJ), but less prevalently by error-free template-dependent homologous recombination (HR). DSB repair pathway selection is the bedrock for genome editing. NHEJ results in random mutations when repairing DSB, while HR induces high-fidelity sequence-specific variations, but with an undesirable low efficiency. In this review, we first discuss the latest insights into the action mode of NHEJ and HR in a panoramic view. We then propose the future direction of genome editing by virtue of these advancements. We suggest that by switching NHEJ to HR, full fidelity genome editing and robust gene knock-in could be enabled. We also envision that RNA molecules could be repurposed by RNA-templated DSB repair to mediate precise genetic editing.
|
| Year:
2022 |
|
|
Category: W |
|
Myostatin increases the expression of matrix metalloproteinase genes to promote preadipocytes differentiation in pigs
|
|
In this study, RNA sequencing (RNA-seq) was used to screen differentially expressed genes (DEGs) in porcine fat tissues. We identified 285 DEGs, including 4 adipocyte differentiation-related genes (ADRGs). Matrix Metalloproteinase-2/7 (MMP-2/7), fibronectin (FN), and laminin (LN) were differentially expressed in MSTN-KO pigs compared with wild-type (WT) pigs. To investigate the molecular mechanism, we treated the preadipocytes with siRNA and recombinant MSTN protein. The results indicated that MSTN increased the expression of MMP-2/7/9 and promoted the preadipocyte differentiation. To further validate the effect of MSTN on MMP-2/7/9 expression, we treated MSTN-KO PK15 cells with recombinant MSTN protein and detected the expression of MMP-2/7/9. The data showed that MSTN increases the expression of MMP-2/7/9 in PK15. This study revealed that MSTN promoted preadipocyte differentiation and provided the basis for the mechanism of fatty deposition in pigs.
|
| Year:
2022 |
|
|
Category: W |
|
Compound Homozygous Rare Mutations in PLCE1 and HPS1 Genes Associated with Autosomal Recessive Retinitis Pigmentosa in Pakistani Families
|
|
WES data analysis highlighted two missense homozygous variants at position c.T1405A (p.S469T) in PLCE1 and c.T11C (p.V4A) in HPS1 genes in proband of both families. Healthy individuals of two families were tested negative for p.S469T and p.V4A mutations. The variant analysis study including molecular dynamic simulations predicted mutations as disease causing.
|
| Year:
2022 |
|
|
Category: W |
|
Association of Single Nucleotide Polymorphism in the Upstream Region of Tumor Necrosis Factor Alpha Gene with Asthma
|
|
The objective of the study was to look into single nucleotide polymorphism in upstream region of -238TNF-a and -308 by ARMS PCR technique in asthmatic and control group. It was a prospective study constituting 17 clinical diagnosed asthmatic patients (Diseased) and 19 non-asthmatic patients (Control). The female was 6 (31.6%) and males were 13 (68.4%) in control group while females were 9 (52.9%) and male were 8 (47.1%) in asthmatic group. Mean age (49.59±15.82 year) and BMI (21.96±06.67 kg/m2) were recorded for asthmatic group while mean age and BMI for control group were 32.82±12.50 year and 18.87±05.17kg/m2, respectively
|
| Year:
2021 |
|
|
Category: W |
|
Interferon-a-A (IFN-a-A) Diversity in Domestic Yak (Bos grunniens) of Pakistan
|
|
The current study analysed the genetic variation and phylogenetic analysis of the IFN-a-A gene in domestic yak, with comparisons to other mammalian species to investigate immune diversity level, with the aim of designing molecular selection strategies for better disease resistant animals.
|
| Year:
2021 |
|
|
Category: W |
|
Molecular investigations on the Rajanpuri strain of Beetal goat breed of Pakistan by complete mtDNA displacement region and microsatellite markers
|
|
In this study, we examined variability and molecular phylogeny of breeds. A total of 81 haplotypes were observed in 105 individuals, with a haplotype diversity of 0.984±0.006 and nucleotide diversity of 0.03953±0.00843. Phylogenetic analysis based on the mtDNA hyper variable segment (HVI) of the control region (481 bp)
|
| Year:
2021 |
|
|
Category: W |
|
Sequence Diversity of Interferon Beta-1 Gene in Dromedary Camel Breeds of Pakistan
|
|
DNA was extracted from blood samples through the inorganic method. Different blood samples from different camel breeds were used to analyze the immunological effect of IFNß1. The specific primers ie IFNß1-Fw CGGTGCCTCCTCCAGATGGTTC and IFNß1-rev GGGGAACGATCGTGTCTTCCGT were designed by Primer3
|
| Year:
2020 |
|
|
Category: W |
|
Molecular analysis of Staphylococcus aureus isolated from infected dairy goats
|
|
This study determined the occurrence of S. aureus in infected dairy goats by molecular analysis. A hundred raw milk samples were collected from two infected dairy goat breeds (Beetal = 71: Teddy = 29) and cultured on blood agar media. The strain identified as S. aureus by morphological method (Gram staining), biochemical tests (catalase and coagulase) and further identified through molecular method using the 16SrRNA gen
|
| Year:
2019 |
|
|
Category: W |
|
In Silico Analysis of Hepatitis B Virus Genotype D Subgenotype D1 Circulating in Pakistan, China, and India
|
|
The focus of this study was the computational analysis of hepatitis B virus (HBV) genotype D subgenotype D1 in Pakistan, China, and India. In total, 54 complete genome sequences of HBV genotype D subgenotype D1 were downloaded from National Center for Biotechnology Information (NCBI). Of these, 6 complete genome sequences were from Pakistan, 14 were from China, and 34 were from India
|
| Year:
2019 |
|
|
Category: W |
|
A novel SNP (C.258+43C>T) in LPL gene and association with milk production in buffaloes
|
|
T his study is designed to identify single nucleotide polymorphisms (SNPs) in LPL gene among high and low milk producing buffalo breeds of Pakistan. We selected samples (n= 50) of each Nili-Ravi a high milk producing and Azakheli a low milk producing buffalo breeds. Blood samples were collected for DNA extraction. LPL region of exon 2 region along with exon/intron boundaries were sequenced and data was analyzed for variation detection
|
| Year:
2019 |
|
|
Category: W |
|
Microsatellite based genetic variation among the buffalo breed populations in Pakistan
|
|
Blood samples (10 mL) from 25 buffaloes of each of the Nili, Ravi, Nili-Ravi, Kundhi, and Azi-Kheli breeds were collected aseptically from the jugular vein into 50 ml Falcon tubes containing 200 µl of 0.5 M EDTA. The henol-chloroform method was used to extract DNA and the regions were amplified for microsatellite analysis. The eight microsatellite markers ETH10, INRA005, ILSTS029, ILSTS033, ILSTS049, ILSTS052, ETH225, and CSSM66 were analysed.
|
| Year:
2017 |
|
|
Category: W |
|
Association between the catechol o methyl transferase gene and obsessive compulsive disorder: a case-control study
|
|
This study aimed to find out the genetic variations in Catechol O Methyl transferase (COMT) gene andassociation of these genes with obsessive compulsive disorder (OCD) in the Pakistani Patients. We selectedOCD patients (n=100) following the Diagnostic Statistical Manual-IV (DSM-IV) criteria and controls(n=120)
(3) (PDF) Association between the COMT Gene and Obsessive Compulsive Disorder: A Case-Control Study. Available from: https://www.researchgate.net/publication/319350788_Association_between_the_COMT_Gene_and_Obsessive_Compulsive_Disorder_A_Case-Control_Study [accessed Aug 01 2024].
|
| Year:
2017 |
|
|
Category: W |
|
Molecular Characterization of Bovine Rotaviruses in Pakistan. Jundishapur Journal of Microbiology
|
|
A total of 200 fecal samples were collected from diarrheic buffalo and cattle calves from ten districts of Punjab, Pakistan. Samples were selected on the basis of agro-ecological zones of the province. Fecal samples were analyzed for the presence of BRV using Ag-capture ELISA. Positive samples were subjected to PCR for the amplification of VP4 and VP6 genes and subsequent sequencing. Phylodynamics was performed to infer genetic clustering and evolutionary distances of characterized strains of BRV in accordance to the BRV available publically.
|
| Year:
2016 |
|
|
Category: W |
|
ß(1,4)-Galactosyltransferase-I Gene Polymorphisms in Pakistani Nili Ravi Buffalo
|
|
The present research work was planned to identify the polymorphism in ß4GalT-I gene in Nili Ravi buffalo. Blood Samples were collected, DNA was extracted and primers were designed for PCR. After amplification, PCR products were sequenced for the identification of allelic variation. Thirteen polymorphic, six in coding and seven in non-coding region of gene, were identified
|
| Year:
2016 |
|
|
Category: W |
|
Apolipoprotein-E Gene Isoforms Genetic Spectrum in Pakistani Survivors of Myocardial Infarction
|
|
We aimed to assess APOE genotypes association with myocardial infarction in Pakistani cohort. Serum lipid levels were determined of survivors of myocardial infarction (n=100) and control (n=100) and genotyped using high throughput fluorescence based TaqMan and KASPar assays. The APOE158 risk allele frequency was significantly lower in diseased (p-value 0.025).
Three alleles E2 (15%), E3 (71%), E4 (14%) and E2 (5%), E3 (76%), E4 (18%) were observed among control and MI patients respectively.
|
| Year:
2016 |
|
|
Category: W |
|
Comparative Genetic Diversity of CYP11b1, OLR1 and SCD Gene in Bovid and non-Bovid Species
|
|
Present study was planned to probe the rate of molecular evolution of three genes (CYP11b1, OLR1 and SCD) involved in milk fat contents. The DNA sequencing phylogenetic analysis and construction of Neighbor-joining trees for these genes showed buffaloes sharing cluster with other
members of bovines as cattle, sheep, goat etc. So it was concluded that along with similarities with
respect to morphologic and genetic characters, buffaloes and some other bovines are evolutionarily less divergent with respect to selected candidate genes.
|
| Year:
2016 |
|
|
Category: W |
|
A Genetic Variant (S4338N) in Apolipoprotein B Gene in Hypercholesterolemic Families from Pakistan
|
|
We aimed to assess genetic variations in exon 29 of apolipoprotein B (ApoB)
gene in FH patients from 10 affected families of Punjab origin. A guanine to adenine change
(c.G13013A: rs1042034) was detected in 9 families, resulting in serine to asparagine change
(p.Ser4338Asn, S4338N).
|
| Year:
2016 |
|
|
Category: W |
|
Evaluation of Pakistani goat breeds for genetic resistance to Haemonchus contortus
|
|
This study aimed to evaluate the genetic resistance of Pakistani goat breeds (Beetal, Teddy, Angora, Nachi) against Haemonchus contortus. In total, 13 animals of each breed, irrespective of sex, were selected.
|
| Year:
2015 |
|
|
Category: W |
|
Missense mutations (p.H371Y, p.D438Y) in gene CHEK2 are associated with breast cancer risk in women of Balochistan origin
|
|
The main goal of this study was to evaluate and to compare the role of truncating mutations, splice junction mutations and rare missense substitutions in breast cancer susceptibility gene CHEK2. Present study was performed on 140 individuals including 70 breast cancer patients both with and without family history and 70 normal individuals. Written consent was obtained and 3 ml intravenous blood was drawn from all the subjects.
|
| Year:
2014 |
|
|
Category: W |
|
Evaluation of Genetic Resistance to Haemonchus contortus Infection in Pakistani Sheep Breeds
|
|
This study was conducted on four sheep breeds, Karakul, Kajli, Thalli and Kachhi for their natural resistance against Haemonchus contortus.
|
| Year:
2013 |
|
|
Category: w |
|
Microsatellite markers based Genetic Diversity Analysis in Damani and Nachi Goat Breeds of Pakistan
|
|
This article is related to the important goat breeds of Pakistan for their molecular characterization
|
| Year:
2013 |
|
|
Category: W |
|
High conservation of SRY gene in Buffalo compared to other Bovids
|
|
This article is on sex-determining region Y (SRY) in two Pakistani buffalo breeds Kundi and Nili- Ravi
|
| Year:
2013 |
|